CX299916

Overview
NameCX299916
Unique NameCX299916
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length510
Alignments
Feature NameTypeLocationAnalysis
CX299916_ssr446 microsatellite CX299916_ssr446:446..459.
Ccv1_Contig10042 contig Ccv1_Contig10042:36..543. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004A02SK SaltLeaf1 Citrus clementina cDNA clone C07004A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299916 ID=CX299916|Name=CX299916|organism=Citrus clementina|type=EST|length=510bp
AAGCATCATATAATCAACTGTTTGTTCCAATCTTTCATAAGAATCCGAAA
ATGGCTGGATCCGGTGGAAGTGTTCCTGCTCAGGCTACTGATTTCTCCTA
TGAAGGTGACAATAAGAATGTTATCGCCGAGAGCCTTGAAGTAGTTCCTG
AAGTTGCACCAGAGAAAGTGAACGAGGGAGACGACAACGGCGGCTGCAAG
TGCAACCCATGCAACTGCAACCCGTGTAACTGCAGCAAATGAGAGACAGA
TGCGCCATGCGGCCTATGGAATTAATTAACCAGCTGCCTGTTTAAAAGCA
TATATATGGATCTTTTTTAAATAAGAACTAATATAGAATCTAAGACCTAT
GTTTGCTTCTGCTTCAATGGCTTTCTTGTGAACGTTTGTAGAATATAGAA
TAGACTACTGTTTTATGTACGAGTCTCTGCTTTGAGTTATGTGGTTATAT
ATATATATATGAATAAATGAATAGTATTTTTCTTTTCCTGTTCAAAAAAA
AAAAAAAAAA
back to top