CX299940

Overview
NameCX299940
Unique NameCX299940
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length456
Alignments
Feature NameTypeLocationAnalysis
CX299940_ssr304 microsatellite CX299940_ssr304:304..315.
CX299940_ssr199 microsatellite CX299940_ssr199:199..213.
Ccv1_Contig9653 contig Ccv1_Contig9653:441..896. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004C04SK SaltLeaf1 Citrus clementina cDNA clone C07004C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299940 ID=CX299940|Name=CX299940|organism=Citrus clementina|type=EST|length=456bp
CAAGTACGAAACTGATCATTATTGGTACGGACACGGATATGGCCATGGAC
ATAAATATGGTCATGGCAAGGGATACGGACACGGTGGATATGGACATTAC
GGCAAGCCTGGCCATGGAGGTCACCCCGGACACGGTGCTGATGGAGTTGA
AACCGAAGATGGAGGGAACTAAATAAACCCTTGCTAACCTAGCTAAGCCT
TCTTCTTCTTCTTCCTTGTTGGCTAAGCTAGGTCTTTTATGAATGTGTTG
CTTGCTGAAATAAATAACTAAGCTTTAGTTTATGAATGTTTTCTTGTCAG
CAAGTGTGTGTGTGTAAGGCTCGATATTGAGATGTGGCCATGAATGTTCT
TTTATAAGGCACCATGGTTACGTTGATATTGATCGGGTAATTTGTACTAC
TATAAAATATATAAGTGTTTTACTTCTTGTGCAAAAAAAAAAAAAAAAAA
AAAAAA
back to top