CX299944

Overview
NameCX299944
Unique NameCX299944
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length532
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004C08SK SaltLeaf1 Citrus clementina cDNA clone C07004C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299944 ID=CX299944|Name=CX299944|organism=Citrus clementina|type=EST|length=532bp
GATGGGCAATACAATGAGATGGCAAAGGGTTGGCCTGAAAATGTGAAGCA
TGCATTGCATGAGCACGAACTTGTGCTTGATCGCTGTGGGGTTTACAGTT
GCGATGGATGCGATGAGGAAGGACGTGTATGGGCATTCAGCTGCGATGAG
TGTGACTTTTGTCTCCATCCCAATTGCGCCTTGGGAGAGGACAAAGGAAC
CAAAGATGACAAATCAGAAGAACAAAATCCCTCCAAAGAAGGATGGCGTT
GTGATGGGGGGCTCTGTTACAAAGGTTGAGACACTGGTCTTTCAATTCTG
AGAAGAACTGTGGTCATTTCATAATCATCTTGCCTTACTCGCTTGGGATT
ATGTTATTCATGAATGGTTTATATGTAATAGCAATGTAGGCTATGAAGTA
CGTAGAGTAGTATGATGGCGTGAAATATGTGTGCCTTATGGGTGCTTCTG
GTATCAAATTATATGGTATGCTGCAATGCTTACATATTTTTATAGAAGTG
GCAGCAATCGAGCGAAAAAAAAAAAAAAAAAA
back to top