CX299951

Overview
NameCX299951
Unique NameCX299951
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length509
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of CX299951 vs. ExPASy Swiss-Prot
Match: STT7_ARATH (Serine/threonine-protein kinase SNT7, chloroplastic OS=Arabidopsis thaliana GN=SNT7 PE=1 SV=1)

HSP 1 Score: 199.519 bits (506), Expect = 7.240e-51
Identity = 94/127 (74.02%), Postives = 115/127 (90.55%), Query Frame = 1
Query:    1 KARQRISAKTSLAHPYFDREGLLALSFMQNLRLQFFRATQQDYSEAAEWVIQRMAKSGTEKEGGFTEAQLQELREIKPLRKGSAQRNALASALKLQRRIVRTLNESMDEFNIRQKSLWWSRWIPREE 381
            KARQRISAK +LAHPYFDR+GLLALS MQNLR+Q+FRATQQDYSEAA WVIQ MAK+GTEK+GGFTE QLQELRE +P +K +AQRNALASAL+LQR++V+T+ E++DE +  +K++WW+RWIPREE
Sbjct:  436 KARQRISAKAALAHPYFDRQGLLALSVMQNLRMQYFRATQQDYSEAANWVIQLMAKNGTEKDGGFTETQLQELREKEPRKKANAQRNALASALRLQRKLVKTVTETIDEISDGRKTVWWNRWIPREE 562          
The following BLAST results are available for this feature:
BLAST of CX299951 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
STT7_ARATH7.240e-5174.02Serine/threonine-protein kinase SNT7, chloroplasti... [more]
back to top
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004D04SK SaltLeaf1 Citrus clementina cDNA clone C07004D04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299951 ID=CX299951|Name=CX299951|organism=Citrus clementina|type=EST|length=509bp
AAAGCACGGCAAAGAATCAGTGCAAAAACATCTCTAGCTCATCCCTACTT
TGATAGGGAAGGGCTATTAGCTTTGTCCTTCATGCAGAACCTACGGTTGC
AATTCTTCCGAGCCACACAACAGGATTACAGTGAAGCTGCCGAGTGGGTA
ATTCAGCGAATGGCAAAATCGGGAACAGAGAAGGAAGGTGGCTTCACAGA
AGCCCAGCTTCAGGAGCTGAGAGAAATAAAGCCGCTGCGGAAGGGAAGTG
CTCAGAGAAACGCTCTTGCTTCAGCCCTTAAACTGCAGAGAAGGATTGTA
AGGACACTGAATGAGAGCATGGATGAGTTTAACATACGCCAAAAGAGTCT
ATGGTGGAGCCGGTGGATCCCAAGAGAGGAATGAACACTGTAAATACACA
TATTCAATTTTTCTCTTTCTGTAAATTTTGTGTATTAATTTGAACCGACT
GTTCTAATGGAATAGAGTAAACGGAATGACTTGAAATGTAAGAAAAAAAA
AAAAAAAAA
back to top