CX299952

Overview
NameCX299952
Unique NameCX299952
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length725
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004D05SK SaltLeaf1 Citrus clementina cDNA clone C07004D05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299952 ID=CX299952|Name=CX299952|organism=Citrus clementina|type=EST|length=725bp
CTTTGTAATGATTCAACCATTCATGGGTTTGTTTGTATGTTAGCGGGCTG
CATTATGTTTAGCCAGCAGTTTCATGCATGGGCTCATAGCACAAAGAGCA
AGCTGCCGCCATTAGTAGTGGCGTTACAGGATGCTGGAGTGCTTGTGTCG
CGGTCGCAACACGCTGCTCATCACAGGCCGCCTTATAACAACAATTATTG
CATAGTGAGTGGTGTATGGAACGAGTTTCTGGATAAACAGAAGGTTTTTG
AAGCATTGGAGATGATCTTGTTCTTTAAACTTGGTGTTCGACCTCGATCC
TGGAGTGAACCTAGCTCTAAATGGATTGAAGAAGCTTGAGAGTCCAAGAT
CTAAACTTTTAGTCCACTGATTTTTTTTTTTTAATTTTCTGATGGCACTA
TTATTTTTCCTTAAAAAATCTGCTCCATATTCATGTTCTATTTGATTGCT
AGGTGGAGTAGGAAAACAATGTTAAACAAAAGTTTATAATACAATTCTTC
TGGATACAGATTGTGGGGTGACCTAATTTTAGAACACCTTAAAAGGATCA
TTAAACAGGCAGAGCCGCAGAGCTTTCCTTAGAAAAGAATGCTATTCAAG
GTGTCCATTAGGAAAAAAACTTGAACCAGCATGCGGTTCACAGTGAACAG
CCTCCTTCTGCTCATTTTCAGAGATCCTTTTGTTCTTTTTAAATAATTCG
AGTTGGTATTTAGCCAAAAAAAAAA
back to top