CX299954

Overview
NameCX299954
Unique NameCX299954
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length619
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15383 contig Ccv1_Contig15383:690..1308. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004D07SK SaltLeaf1 Citrus clementina cDNA clone C07004D07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299954 ID=CX299954|Name=CX299954|organism=Citrus clementina|type=EST|length=619bp
AAAGGTTTTTCAGCCTCCTCCTGGAATGAAATATAAGTGCCCACCAGTGG
TAGTTGCAGCCCGAGCAGCTATAGCACGAACTGCTTTCGCAAAGAGTCTC
CGTCCGCAACCCTTGCCTGCAAAAGTACTTGTGATTGGGATGTTGGGCAT
GGCAGCAAATGTTCCTTTAGGTATATGGAGGGAACACACTGAAAAGTTCT
CTGTATCCTGGATTGTCGCTGTCCATGCAGCTGTTCCTTTCATAGCCATG
ATGAGGAAGTCTGTGTTGATGCCGAAGTCTGCTATGGCATTTACCATTGC
AGCATCTGTATTGGGACAGGTCATTGGTTCGAGGGCAGAGCGATACCGTA
TGAAGGCAGTAACTGAGAAAAGTGTAACTCTCAAGGAAAAGTCTGTCGGA
AGTGCAAGTCAGTTACAGGTTGTTGCCGTTAATGGCGGGCATTGTGCTGA
ACCTGCAAAATGGGATTCGGTTTCTCTCCAGGTGGCAAAATCATCTTCTT
CTGCGGATGTATTTTGTTGATCTTGATGTTGTTTCGCCGAGTATATCTGC
TGATTGATTGTACCTCTCTATCCTACAGATTGATTATCGTTTTGAGTAAT
TTAAAAAAAAAAAAAAAAA
back to top