CX299960

Overview
NameCX299960
Unique NameCX299960
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length359
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14677 contig Ccv1_Contig14677:915..1276. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004E02SK SaltLeaf1 Citrus clementina cDNA clone C07004E02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299960 ID=CX299960|Name=CX299960|organism=Citrus clementina|type=EST|length=359bp
GTGATCAGAGCCATTCCCTTCAAATGAAGCTGATCGCTTCATCGACGTTC
GTGATTGCACCTGCATTTGTTTATGGCTGTTGCTGGTTTGCTTATGTGTA
TTATAAAATATTAATTAGTCCTTTGTTCAAATCTGCTGGTGCTGGACCTG
GACCTGCTTCTGTGTTTTCCTTCCTTAAAACGTTTTTTTTTTTTTTTTGA
AGAGAGGTCGATGATGATGACGGATGGGCCCATGGCTAAGTAGGTGGGCG
CTGTCACTTTGTACATTTGTATGGCTGTGGATTTGTGCAATGTCATCTTG
GTAATAATATGGACAAAACTAGTTCTATTACTTTTATTAAAAAAAAAAAA
AAAAAAAAA
back to top