CX299961

Overview
NameCX299961
Unique NameCX299961
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length515
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9878 contig Ccv1_Contig9878:8..522. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004E03SK SaltLeaf1 Citrus clementina cDNA clone C07004E03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299961 ID=CX299961|Name=CX299961|organism=Citrus clementina|type=EST|length=515bp
CAAAAGCAAAGCAAGATAAACACAGATCCGCATCCGCTGACCCACATTGC
AAAGACCCAAAACAACTCTCTGGAAATATTAGAAAAGATGGCGGTGATGG
AGAAGCTGAGAATGTTTGTCGCACAAGAGCCGGTCGTTGCAGCTTCTTGC
CTTATGGGTGCTTTTGGCCTCTTCCTTCCAGCTGTTGTAAGGCCCATGCT
AGACTCCTTTGAATCATCCAAACAAGTGCCTCAACCTGCGTTAAGCGATG
TGGTTGCAGGTGTGACTGGGAAAAAACAGCAGTGATTTGATTTACGAATT
AACTTGAAGATCTTAGCACACTGTTCGGGTCTGCGATTTTTTGTTTCTAT
CGTATCAACAATGAAATAAGCCTGAGTTTTAACTGTGAAACAGGACAAAT
GAATTTGTTGCATATTGGACATCATCATATTTTGTGTAGAATTATGAATA
TTTCATGTTGTGTTGAATTTTAAATCAGCAAAGGTTCATTGGGACCAAAA
AAAAAAAAAAAAAAA
back to top