CX300191

Overview
NameCX300191
Unique NameCX300191
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length417
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007C07SK SaltLeaf1 Citrus clementina cDNA clone C07007C07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300191 ID=CX300191|Name=CX300191|organism=Citrus clementina|type=EST|length=417bp
GGGAGAAAAAAATGGGATGCTTTGATTGCTTCGATGGGGGAAACAAGCAG
CAGAGGAAGGAACAAGAGAGATTGGCTTCTGCAGAGGCTCGAGCCAGGGC
TGCTGAGGCCGCCCAAAATCGGCAAGAGCAGTTTGAAAAGTCTGCCGCCG
GAAGAGCTGCTCGTGCACAGATGGAAGCGATGGCAAAGCAATCTGCTAAT
ACTAACAAAGGCGAACCAGTTCTAAAGTGGCAAATGAACTGATGACATGC
TACTTGTCTGTTTACTACATCTGTCTATTTTCAAAAATCAGTTCCCCTCG
CTTATTTCCAGGTGTTGTTTTCTACACATGGAGTCCTGATCGATTGAGCT
GATTTCTATGCTGTGAGAGAAGCGGATGGCCAGTAACTTTTCAGTCTGTT
TAGCATCATTTAGATTT
back to top