CX300192

Overview
NameCX300192
Unique NameCX300192
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length453
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9503 contig Ccv1_Contig9503:67..519. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007C08SK SaltLeaf1 Citrus clementina cDNA clone C07007C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300192 ID=CX300192|Name=CX300192|organism=Citrus clementina|type=EST|length=453bp
ACAAGCTATGAGGGCTTTCCGTGCTCAGAATGTAGAAAGTGCAAAATCAA
GACTCAGTCTCTGTACAGAAGATATCAGAGATCAGATAGAAAGAATGGGC
AATACATCAGAGTTGTGTTCACAGCTAGGAGCTGTTCTGGGTATGCTTGG
TGACTGCTGTCGAGCTATGGGAGATGCTGATGCTGCAGTGGCTTATTTCG
CAGATAGTGTTGAATTCCTCATGAAATTACCGATGGATGATCTGGAGATA
ATTCATACACTTTCTGTTTCACTAAACAAAATTGGAGATCTGAAATATTA
TGGTGGAGACCTGCAAGCTGCAAGATCTTACTATGTCCGTTCTCTAAATG
TCCGACGTGATGCCGTCAAACGTCATTCAAATGTTCCATCACAGGTTTTG
GATGTAGCTGTTTCTCTTGCAAAAGTTGCGGATGTAGATAGGAGTATTGG
TAA
back to top