CX300197

Overview
NameCX300197
Unique NameCX300197
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length295
Alignments
Feature NameTypeLocationAnalysis
CX300197_ssr32 microsatellite CX300197_ssr32:32..43.
Ccv1_Contig15434 contig Ccv1_Contig15434:264..558. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007D01SK SaltLeaf1 Citrus clementina cDNA clone C07007D01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300197 ID=CX300197|Name=CX300197|organism=Citrus clementina|type=EST|length=295bp
GTTCTTTTATGATGATCCGGAATCGGAATTGGCTGCTGCTGCTGCAACAA
ACGTATTGAATTTGAATCCCTTGAAGCGACGTCCAGTGTTCGATTGCGGA
AAAGGCCGAGGCCGAAGCTATCGCTCTTGTACCCCTCCTCCCCAGGGTTC
CAAAAGGGGTGAACATTGCAAACCTGCACCCGGCGGCACGTACAATCGAG
GGTGCAATTATTAAGCCTTAAGTTTGTACTGCTGCATCCATGCATATGCA
TTAATAAATAAATTAATTGAAACTTCTAAAAAAAAAAAAAAAAAA
back to top