CX300206

Overview
NameCX300206
Unique NameCX300206
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length443
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10042 contig Ccv1_Contig10042:19..461. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007D10SK SaltLeaf1 Citrus clementina cDNA clone C07007D10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300206 ID=CX300206|Name=CX300206|organism=Citrus clementina|type=EST|length=443bp
GTTTTTCGCCGTACATCAAGTATCATATAATCAACTGTTTGTTCCAATCT
TTCATAAGAATCCGAAAATGGCTGGATCCGGTGGAAGTGTTCCTGCTCAG
GCTACTGATTTCTCCTATGAAGGTGACAATAAGAATGTTATCGCCGAGAG
CCTTGAAGTAGTTCCTGAAGTTGCACCAGAGAAAGTGAACGAGGGAGACG
ACAACGGCGGCTGCAAGTGCAACCCATGCAACTGCAACCCGTGTAACTGC
AGCAAATGAGAGACAGATGCGCCATGCGGCCTATGGAATTAATTAACCAG
CTGCCTGTTTAAAAGCATATATATGGATCTTTTTTAAATAAGAACTAATA
TAGAATCTAAGACCTATGTTTGCTTCTGCTTCAATGGCTTTCTTGTGAAC
GTTTGTAGAATATAGAATAGACTACTGTTTTATGTACGAGTCT
back to top