CX300209

Overview
NameCX300209
Unique NameCX300209
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length412
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig8288 contig Ccv1_Contig8288:10..421. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007E01SK SaltLeaf1 Citrus clementina cDNA clone C07007E01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300209 ID=CX300209|Name=CX300209|organism=Citrus clementina|type=EST|length=412bp
ATTTGTCTGCAAATCTTCTCATCGTTATATCACCAAAGGAAAACAAAAAA
TGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCTAGCTGCAAGTGCGGC
GGCGGCTGCGGCGGCGCCATGTACCCTGACTTGAGATCCTTTGAGAGCAC
CACCGTCGCCACCGAGACCCTCGTCCTCGGTGTTGCTCCTGTCAAGATGC
ACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGAGGGCGGCTGCAAGTGT
GGACCAAACTGCAAGTGCAACCCTTGTAACTGTTAATGAAGATTACGAGA
CGTGAACATGCCCCATAATAAAGCAGCGCTGTGAGGTCGTTTAAATTGTA
GTATCAATAAAAAGAACTATTTGTCTTTTGCGGATGGCTTTGTTGGATGT
CTTTTTATGAGC
back to top