CX300213

Overview
NameCX300213
Unique NameCX300213
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length294
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig13245 contig Ccv1_Contig13245:146..439. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007E07SK SaltLeaf1 Citrus clementina cDNA clone C07007E07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300213 ID=CX300213|Name=CX300213|organism=Citrus clementina|type=EST|length=294bp
GTGGATAGCGATTGTGCGAGGTTTCGGTATAGTACGCTGGTCTTGCTAAA
GTGCGCGATGGGTTTACTTGACCAATTGTGGGACGACACCGTGGCCGGGC
CGCGCCCCGAGTCCGGGCTCGGCAAGCTACGAAAGCACTCCAGTTTCAGT
TTCCGGTCAAGTTCCGGCAAGGGTATGCAATTAGCCGGCCGCGCCTTTTT
AAAGAACAAACAGTAATATATTAAAGTGAAATTAACGAAAATCATGAAAT
GAAACTAATCATAACTTTCGTTTCGAAAAAAAAAAAAAAAAAAA
back to top