CX300214

Overview
NameCX300214
Unique NameCX300214
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length421
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig831 contig Ccv1_Contig831:1..421. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007E08SK SaltLeaf1 Citrus clementina cDNA clone C07007E08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300214 ID=CX300214|Name=CX300214|organism=Citrus clementina|type=EST|length=421bp
TCGAAAGCATCAGTCGATCATCGGCAGAGATCGAAGAAAGTAAATGGCAT
CGGGATGGGGAATCAACGGCAACAAGGGGAGGTGTTACGATTTCTGGATT
GACTTCAGCGAATGCATGTCGCGCTGCAGAGAGCCCAAGGACTGCTCTCT
CCTTCGTGAGGATTACCTCGAGTGCCTCCACCACTCCAAAGAGTTCCAGC
GGAGAAATCGAATTTACAAGGAGGAGCAGCGTAAAATAAGGGCAGCTGCA
AGAAAGGCCAAGGGTGAAGATGTCATTGATAATCATCATGCGTAGCCAGA
ATTTAATCAATAATCATTTGAATTTCAAGAGTAAACCATGTGGAGCTGCC
GTTGTTTTGTCGCTTATTTGTTCAAAGTCACCTGGTTTCTTTGTTTTCCC
TTGAATAGACATGCACTTTTC
back to top