CX305097

Overview
NameCX305097
Unique NameCX305097
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length255
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18001A07Rv Drought1 Citrus clementina cDNA clone C18001A07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305097 ID=CX305097; Name=CX305097; organism=Citrus clementina; type=EST; length=255bp
GCGGGGACACAACATACAACGACCTGAAGAAAAGTTCCAAGTTAAGCAAC
ATTCTCATTTCTCAGAGCTAATTAAGAACATTATACATGGCTCTTAAGCT
TGCTTGTGCTGTGCTGCTAATGTGCATGGTGATGGGTGCGCCCATTGCCC
AAGCTGCCGTCACATGTGGCCAAGTGACAAGCTCTCTTCAAGCGTGCATG
CCATATGTGACGGGCCCCGGTGGAGGCGCTGTGCCGCCAGCCTGCTGTAG
CGGGA
back to top