CX305099

Overview
NameCX305099
Unique NameCX305099
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length364
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18001A09Rv Drought1 Citrus clementina cDNA clone C18001A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305099 ID=CX305099; Name=CX305099; organism=Citrus clementina; type=EST; length=364bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACTGAACTTTTACATTGAAC
CCATTGCAATTGCAGGCTGTAAAAATGCCGCCTGGATTAACAAATTTCAA
TTACAATCATAAATAGCTACACGCGTTAGCATTAATCCCCAGACGTTAAA
GGGCAGCATCTCTAATCCTAATTCCTGAACAGCTAAGATCATATAACATA
ATCTTGCAGTTGCAGCTATGTATTTTATTTTCTACCAGCACTGATCAGTC
TCCCATGTCCGCCTTGAGTTAGGCACAAAATTTTGAATTCGACGAAGTGG
CCATCGTATTTGCCACTCCCGAGACCGCAAATGGGGAACCCGATGGCCTT
CTTCGCCTGAAAAG
back to top