CX305102

Overview
NameCX305102
Unique NameCX305102
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length139
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC18001B01Rv Drought1 Citrus clementina cDNA clone C18001B01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305102 ID=CX305102; Name=CX305102; organism=Citrus clementina; type=EST; length=139bp
GCGGGGATGCTTAGCAGGCTTGTTTATGGAGATTTGAGCAAGTATGGTAT
CCCCAAGCCCAGGGAAGGTCCTTTTTTCATGAAAGCTGCTTATGGAAAGT
ACCCGGTTATCGATGCCGGTACCTGTGAGAAAATCAAGT
back to top