CX305105

Overview
NameCX305105
Unique NameCX305105
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length132
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18001B05Rv Drought1 Citrus clementina cDNA clone C18001B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305105 ID=CX305105; Name=CX305105; organism=Citrus clementina; type=EST; length=132bp
GCGGGATCTGGCAACTGCCTCTGCCTAATAAGTTATAACTATCCTCCTGC
CTTTTGGCTTTAGAGGCTATAGACCTCAATATATGCTATCAGTCTGTAAT
TTACTTATTAGAGTGGTTATGGGATTGTGTTT
back to top