CX305108

Overview
NameCX305108
Unique NameCX305108
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length269
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC18001B09Rv Drought1 Citrus clementina cDNA clone C18001B09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305108 ID=CX305108; Name=CX305108; organism=Citrus clementina; type=EST; length=269bp
TTTTTTTTTTTTTTTTTTTTTGACCATATAAACAAGCCAGCCATACCTTT
TCACACCAAATTCTTTTGCTATTATATCCATTCCTTCATCATTGCTATCA
TCACTATTATAATCATCCTCATCATCATCCTCGCCTTCATCCTCCTCGTC
TTCATCATCTGGAAAATGTTGTCCCTCACTTCCATTCCCATCATAAGAGA
ATCCAACCTGTGAGTATGTCCCCTTGCTTGCAAATGGTTGTGACGGATGA
AATCTTCCAGATGTGAAAG
back to top