CX305113

Overview
NameCX305113
Unique NameCX305113
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length215
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18001C04Rv Drought1 Citrus clementina cDNA clone C18001C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305113 ID=CX305113; Name=CX305113; organism=Citrus clementina; type=EST; length=215bp
TTTTTTTTTTTTTTCTTTTTTATTCACAAAAAGGAAACTTTTATTACATA
ACTGTAGTGCCCATGAGCACTTTTTGATACTTTATCAGAAGTTTTATTTT
ATTTATGAACTAAGTTTATAGAGGGATACTTAATTAATAAATTAACCCTA
TTACAGCATTAAGCTTCGATCGATCATGGAATTATAGATGGTGCTTTAAT
CATTGCAGCTCACAA
back to top