CX305115

Overview
NameCX305115
Unique NameCX305115
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length500
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC18001C07Rv Drought1 Citrus clementina cDNA clone C18001C07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305115 ID=CX305115; Name=CX305115; organism=Citrus clementina; type=EST; length=500bp
GCGGGGACACTTACAAGAACGACTACTGGTCTGATCCAGATGCTAACCAT
ATGGGCATTGACATAGCAAACTTAACATCGAATCCAGCCAAGAGTCTCGA
CAGCTCTGGTATTGATCTCAAAAGTGGAAGACCGATCCAGGTTCACATTT
ATTACGATGGATGGACGAAAATACTCTATGTTTATGTGGCATATGCGGGG
AACCCACTTCAGAAGCTTATTGAAAGACCTATCCTCTTGTCAGAAACAAT
TCCAAGCTCAGTCTATGTTGGCTTCACAGCATCCACAGGGCCCGACTTTT
CAGAAAGCCATCAGGTGCTTGATTGGACCTTCACAACGTTCCCATTGCCT
TCTTCTTCTCTGGAGGAGCAAAACCTGGCGATGCCAATATAATTCTAAAC
CGTCCTTGAAAAACCATGTCACATAAAAAATTATAATAAATAAAAATAAC
TAATATCGTCAATAAAGTGACATGGCTCTAGAAGCTGACTAAGATTAATA
back to top