CX305196

Overview
NameCX305196
Unique NameCX305196
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length555
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC18002D06Rv Drought1 Citrus clementina cDNA clone C18002D06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305196 ID=CX305196; Name=CX305196; organism=Citrus clementina; type=EST; length=555bp
GCGGGGACATAGCAAACTTAACATCGAATCCAGCCAAGAGTCTCGACAGC
TCTGGTATTGATCTCAAAAGTGGAAGACCGATCCAGGTTCACATTTATTA
CGATGGATGGACGAAAATACTCTATGTTTATGTGGCATATGCGGGGAACC
CACTTCAGAAGCTTATTGAAAGACCTATCCTCTTGTCAGAAACAATTCCA
AGCTCAGTCTATGTTGGCTTCACAGCATCCACAGGGCCCGACTTTTCAGA
AAGCCATCAGGTGCTTGATTGGACCTTCACAACGTTCCCATTGCCTTCTT
CTTCTCTGGAGGAGCAAAACCTGGCGATGCCAATATAATTCTAAACCGTC
CTTGAAAAACCATGTCACATAAAAAATTATAATAAATAAAAATAACTAAT
ATCGTCAATAAAGTGACATGGCTCTAGAAGCTGACTAAGATTAATATTGT
TGGCTTGCTATCTGAGATGTTCTGCATGTACTTGTGTAGAAATGTTCATA
TTCAGCTTCTATTGATTACGTTGCAGCTTTGACAAAAAAAAAAAAAAAAA
AAAAA
back to top