CX305199

Overview
NameCX305199
Unique NameCX305199
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length292
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18002D09Rv Drought1 Citrus clementina cDNA clone C18002D09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305199 ID=CX305199; Name=CX305199; organism=Citrus clementina; type=EST; length=292bp
TTTNTTTTTTTTTTTTTTTTTTTTCGATGCATGCAATAGGTAGCATCTCC
ACAAATCATTTTATCTGCTTACCAGTTTGAAAATGAATAACAAAGTTCTG
GAGAAACTACTGTTATTAGATTTCTCTGTCTCTGGATTGTTGATAACTAA
AATAAGTTCTGAGTTTGAAAATGTATACATTTAATCATCTAAAACAATGA
CCCCCGTCTTGTCTCTCTGAGAATTTTCTTTCCCAGTAGGCTTATCATCA
GTTTTGATGTCAGCGTCATTTTTAGCTTCTGCCATTTCCCCG
back to top