CX305202

Overview
NameCX305202
Unique NameCX305202
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length586
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC18002E01Rv Drought1 Citrus clementina cDNA clone C18002E01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305202 ID=CX305202; Name=CX305202; organism=Citrus clementina; type=EST; length=586bp
CGAGGGACTCTTTTTTTTTTTTTTTTTTTTTTTTCCAAAACGTATTCTCA
TTTCACTAAGTGACTTCAGAACTGGAATTAGAAAGACAATCTCATATACA
ACAGCATTGTGCTGTAACAAACATGCCAAAATTCTCAGACGACCATTTTT
CCTAAGTTCAAAATTGCTGAGTCAAAAAAAGCCCTCGTTGGAGCTTCCCA
GTAACATCATCCAAATCAATGACTCCTGGCTCAGGTCTTTTCTCCATCTT
AATCTTGTTAAGCTCTGAATTTAGTTCAGCAATCTGCTTCTGTAATTTTG
TTCCCTTGTCTGGTAATCTCTCTACGGTAACACATTGGTAAAACTCCTCT
TCAAAAATCAGCTTCCAAGGAAAGGAAGCCCAAATACTTATAAGCCCACA
AGCCAAGCCTTGTTTGATATAAGTTGTGACAGCCTTTTAATTCTTTCCTT
GATATCAGACTCTTTTAATTTAGCTTCATTTTTTGGGGAAGAAGATTTTT
TGTCCAGTTTTATGTCTCTAGGATTGAACGCATACTCAGCCCCATCGACG
TTTCGTGCAACCAAGTAGCTAGATGACGAATTACCA
back to top