CX305215

Overview
NameCX305215
Unique NameCX305215
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length357
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18002F03Rv Drought1 Citrus clementina cDNA clone C18002F03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305215 ID=CX305215; Name=CX305215; organism=Citrus clementina; type=EST; length=357bp
AAGTAAGGCGGTCGATTATAGAAAAGACAGACTGGAAAAGACTGGTAAAT
AAAAAAGTATTAGTATTAAAAAAGTATTAGTATTAAAGTAACGGAATTCT
TTTGATTGAATCAGGAATCAAAGTTTGTATTTGGTGTGTGGATAAAAGAG
CTGCCTATGTTATACTATTGAATTCTCGACGATGAATCGACTTGACAGTC
AAATATTGTTATTCATGATATTGATCCCATTCGCTGTCATCGAAATGTAA
TTCATCCCATTGAATTTACAAGCGAAAGGGTTATCATCTCTATGGGATTA
AATCCCGAGTTATTGCGAAGTAAAGAAAAAAAAAAACGAAAAGACTGGAA
GTGCCTT
back to top