CX305275

Overview
NameCX305275
Unique NameCX305275
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length536
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18003E06Rv Drought1 Citrus clementina cDNA clone C18003E06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305275 ID=CX305275; Name=CX305275; organism=Citrus clementina; type=EST; length=536bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTACATAAAGGTTGTATTATTACAC
TCATTCGTAGAACCCGATTGTTGGATATCACGCACATCCATGCATGCTTT
ATTAAACAACACTACTTGTTCATTTATTTTACTAATACATAGTTAAGTGA
TTATAAACAAGCAGTTAATCCTGACCATCCATCCAGCCATGATGATTGCA
GATAATCGTCGAAGTTCAGCCAATCCGAGGAACTTGAACCACCTTCTCAT
ATTTGTCAACCACAACTCGAACCCGATCACAACGAAAATCTTGGTAACTG
GAGTTCCCTCAAGTATTATGATTGCATGAACATTAGGATTCTCTTTCTGT
ATCGTAGCAGCAGCAATCTCCCCGTTTACACCAACCAGTTCTGGTCATGA
GCTCTTGCCATTACACTCAAATTGAGTTACGATATCGCAATTGCTGGTAG
CCATGAGGAGCTCCTGGCCATCCGAATGAAGCACTAACGGCTCATGACGA
GCAGCCAAAGATGGTTTTGCAGCAAAGGCAAAGAGA
back to top