CX305280

Overview
NameCX305280
Unique NameCX305280
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length489
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC18003F03Rv Drought1 Citrus clementina cDNA clone C18003F03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305280 ID=CX305280; Name=CX305280; organism=Citrus clementina; type=EST; length=489bp
TTTTTTTTTTTTTTTTTTTTTTTTGGATCAAAACAAAGAACACTTGATTT
TGATTTATGTTCAACTAGAAATAACGTTATAAGGGATACAGCCAACAGTG
GAATTTATTAACACCGAAAGGATCACAGGCTTTCTTCTTCATAATTTTAT
TAATCCTAGAGATTAAAGAGCAGCTAGCCTGGTCCGTTATTTAGAATAAT
AATACTGCTAGCCGGTTAGGGTACATTGATTACACAGACGTTGATCTTTC
TGTAGCGGGAATTAACACAACAGGAAATGCCGGCTCATCATCACGAACCA
GAACCAGACGTCGAACGCCATCCTCAAACGAACGGCCAACGTTGTTGCAG
AGTTTGACACAAGACTCGCAAACGGATGGACAATGAACGATTTTGTATAT
ACCTGGAAAATTTCCAATTTTCTCAAGCTTAAACCAATTTAGCAAAGTTT
CAGCTCCAGGGTGACCATCAAGTCCCCCGGTTGTTCCCG
back to top