CX305781

Overview
NameCX305781
Unique NameCX305781
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length322
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18010B11Rv Drought1 Citrus clementina cDNA clone C18010B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305781 ID=CX305781; Name=CX305781; organism=Citrus clementina; type=EST; length=322bp
CCGGCGTCCCGGCCGACGGACACGCGGGCCATTCAATAAGTAGCCCTCGC
AGAACAAAAAATGATTTTCCTACTACTCCTCTCCGTTTTTCTTCGCGGAG
CTTCTTCATCAATCCTTTCCGAAGACACACCTATTAGCTTCTCATTTCCC
TCATTCGCCAAAGACAGGTGTGACAATAAGACCCTCATTTGCTACGGAGC
GATTGAAAGTTCCGGCGCCTTAAGCATCACACCAGGCCCTCCACCAAACC
TGCCGATCAGGAAGGTTGGACGGGTTTTATACGGCAAGCCTCTGAGTTTA
CAGCGATCTTTTATTGATACCA
back to top