CX306079

Overview
NameCX306079
Unique NameCX306079
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length410
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18013G01Rv Drought1 Citrus clementina cDNA clone C18013G01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX306079 ID=CX306079; Name=CX306079; organism=Citrus clementina; type=EST; length=410bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTACTAACAGCGAAAGCATCATAGG
CTATTTTATTTATGCTTAACCATAGAGATTAAAGAGTACTAGCCTGGTCC
ATTATTTAGAATAATACAGCCTGTTGGCTTATTCATTACAGAGACGGAAA
TAACATAGATCTTCCACTATCAGCTGGAAATAACACAACAGGCAAAGGCA
GATTTGGCTGATCATTATCATCAACCACAACTAGACGTTGGACGCCATCC
ACATTAGAAACGCCAACGTCTTTGCAGAGTGTATCGCAAGAACCATTAAC
AAGTGTTGAACAATGAACAATTTTGTATAGACAGGGAATGTCTAGTGCTA
TTTTCATATCAAATATTGATGCACTAACTTTCTCAAGTTTAAAAAAATTT
TGACACGTTT
back to top