CX306083

Overview
NameCX306083
Unique NameCX306083
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length379
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC18013G05Rv Drought1 Citrus clementina cDNA clone C18013G05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX306083 ID=CX306083; Name=CX306083; organism=Citrus clementina; type=EST; length=379bp
GCGGGGGCCATTCAATAAGTAGCCCTCGCAGAACAAAAAATGATTTTCCT
ACTACTCCTCTCTGTTTTTCTTCGCGGAGCTTCTTCATCAATCCTTTCCG
AAGACACACCTATTAGCTTCTCATTTCCCTCATTCGCCAAAGACAGTTGT
GACAATAAGACCCTCATTTGCTACGGAGCGATTGAAAGTTCCGGCGCCTT
AAGCATCACACCAGGCCCTCCACCAAACCTGCCGATCAGAAAGGTTGGAC
GGGTTTTATACGGCAAGCCTCTGAGTTTACAGCGATCTTTTATTGATACC
ACCATCACCATTAAGATCTCACGCCATCAGAATTACACTGATCGTGCCGG
AGATGGCATGACGTTCATTTTTGCAAGCG
back to top