CX306097

Overview
NameCX306097
Unique NameCX306097
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length402
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC18013H09Rv Drought1 Citrus clementina cDNA clone C18013H09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX306097 ID=CX306097; Name=CX306097; organism=Citrus clementina; type=EST; length=402bp
GCGGGGAGAAACAGAAGGAGGTTTTCTGGGCCCCGACGCCGCTCACCGTT
AAATCATGGGCTGACGTGGATGACGAGGACGATGACGATTACTATGCTAC
TACCGCGCCGCCTCAATCCGTTTGGGCCGCTGCGGAATCCGACGACAAGA
AAGAGACCCAGGAACAGGAGCCTGCTGTTGAGGAAAGTGACAGTGAGGAA
GAAGGTCTTGATGAAGTTGATGAGGATGTTGAGGAAGAACATGACAATGA
ACCTGAAAAACCAGTAGAAGTGGAGCAGCCAATAGTTAAAAACCCTCCTG
AAGCTCCTTCAGTACAAAAAGATTCAGAAAGGCAGCTTTCAAAGAAGGAA
TTGAAGAAAAAGGGTCTTGAAGAACTTGATGCCCTTCTTGCTGAGATGGG
AT
back to top