CX306098

Overview
NameCX306098
Unique NameCX306098
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length336
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC18013H10Rv Drought1 Citrus clementina cDNA clone C18013H10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX306098 ID=CX306098; Name=CX306098; organism=Citrus clementina; type=EST; length=336bp
TTTTTTTTTTTTTTTTTTTTGGCACAAACTCAAACAAATTTATTAAAATA
TATATATCATTACACCTCATCACCATAAACAATATAATACAATTATCTCA
TTTTCATATATACTACATATATGTGATCATAATTAATTATTATACATATG
ATTAACCACAATCACATGATTGAGCAAGCATTACGATTTTCATCACTGAA
CATGTTGGTGTAATGGTCGTCCATGGTGCTTTCAGTGACGGTGGCCGTGG
CGGGGATCAACCTAACATGATTAGGAGGAGCTTTTTTATCATAAGCTTGT
GAAACATAAGGATTTGATACAATATTGTAAGGAACG
back to top