CX308534

Overview
NameCX308534
Unique NameCX308534
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length422
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001A09Rv AbsLeaSub1 Citrus clementina cDNA clone C21001A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308534 ID=CX308534|Name=CX308534|organism=Citrus clementina|type=EST|length=422bp
ACACAAACCAAAGGGCCACATACTAATTCTTTCATTCGAAGAGAATACAG
TATTAATGCCGACACTTGTTGATACCAAAATTTACTGACATATTCAAAGC
AACGAGTGATAGAATTAACTATGCTAATTAAACATTCTAAATATTATCCT
GAAATGTGCATCTCAAATGAGTGAAGTAACATTTATTGAGTGGACGGTGA
TGTTGAACATTTTTTAATACCCCATTTTCCCATCCACAATATTGAAGCAC
ATCAATGAGGACGCATCTTCTTGGGATAAATTATTGGAAAGGCTAACATG
CCTCTCAAGTTTTATTTCTTAATAATTGTCTTATCTTAGTGATCATCCAA
TTTTCGTCAAGGAAACTGTCACGTTGATAAACTTAGTCTTTTCCTTAGAC
ATGCGATCGGCAACAATTTCCC
back to top