CX308542

Overview
NameCX308542
Unique NameCX308542
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length501
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig942 contig Ccv1_Contig942:2..502. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001B05Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308542 ID=CX308542|Name=CX308542|organism=Citrus clementina|type=EST|length=501bp
ATTGCCCAGATTATCAAACAACTGATTCTTTTGGATCAGATGTCACACTT
GATCTCACTCTATCTGGGTCCAATCAAGAAACTAGACCCCCTAGAAACTC
GATGCAAGTCTGTGACGATAAAAAGAAGACTGAAGAATATGTGGCATCCT
TAACTAAAGATCCCAGCTTCACCATAGCTGTAGCCGATGCTGTTGCAAGT
TCCATCAATGGCCCCCCACATAGACCAATGTGAACATTTGGGGACTGATA
CATGGATTCTGTATCTTATTCGTAACTTAAGAATATGTGGCATCCTTAAC
TAAAGATCCCAGCTTCACCATAGTTTTAGCCGATGCTGTTGCAAGTTCCA
TCAATGGCCCACATAGACCAATGTGAACATTTGGGGACTGATACATGGAT
TCTGTATCTTATTCGTAAATTAAGGGAGTATAAAGACACATTATGTATTG
AGTAATGGTGGCACACAGAATTAGCTGAGCCTCCAGCTTGGATCAAAACG
T
back to top