CX308543

Overview
NameCX308543
Unique NameCX308543
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length422
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001B06Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308543 ID=CX308543|Name=CX308543|organism=Citrus clementina|type=EST|length=422bp
ACACAAACCAAAGGGCCACATACTAATTCTTTCATTCGAAGAGAATACAG
TATTAATGCCGACACTTGTTGATACCAAAATTTACTGACATATTCAAACC
AACGAGTGATAGAATTAACTATGATAATTAAACATTCTAAATATTATCCT
GAAATGTGCACCTCAAATGAGTGATGTAACATTTATTAAGTGGACGGTGA
TGTTGAACATTTTTTAATACCCCATTTTCCCATCCACAATATTGAAGCAC
ATCAATGAGGACGCATCTTCTTGGGATAAATTATTGGAAAGGCTAACATG
CCTCTCAAGTTTTATTTCTTAATAATTGTCTTATCTTAGTGATCATCCAA
TTTTCGTCAAGGAAACTGTCACGTTGATAAACTTAGTCTTTTCCTTAGAC
ATGCGATCGGCAACAATTTCCC
back to top