CX308551

Overview
NameCX308551
Unique NameCX308551
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length422
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig360 contig Ccv1_Contig360:331..752. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001C02Rv AbsLeaSub1 Citrus clementina cDNA clone C21001C02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308551 ID=CX308551|Name=CX308551|organism=Citrus clementina|type=EST|length=422bp
AGGGAAATTGTTGCCGATCGCATGTCTAAGGAAAAGACTAAGTTTATCAA
CGTGACAGTTTCCTTGACGAAAATTGGATGATCACTAAGATAAGACAATT
ATTAAGAAATAAAACTTGAGAGGCATGTTAGCCTTTCCAATAATTTATCC
CAAGAAGATGCGTCCTCATTGATGTGCTTCAATATTGTGGATGGGAAAAT
GGGGTATTAAAAAATGTTCAACATCACCGTCCACTTAATAAATGTTACTT
CACTCATTTGAGATGCACATTTCAGGATAATATTTAGAATGTTTAATTAG
CATAGTTAATTCTATCACTCGTTGCTTTGAATATGTCAGTAAATTTTGGT
ATCAACAAGTGTCGGCATTAATACTGTATTCTCTTCGAATGAAAGAATTA
GTATGTGGCCCTTTGGTTTGTG
back to top