CX309104

Overview
NameCX309104
Unique NameCX309104
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length286
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008F02Rv AbsLeaSub1 Citrus clementina cDNA clone C21008F02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309104 ID=CX309104|Name=CX309104|organism=Citrus clementina|type=EST|length=286bp
ATCATATGTCATCATCAGCAGCTCCGTCGAATCCTGCATGTTAGTGTTAC
CCTCCCTGGCAGCAGAAACAAAAAAAGCCCTCACTTTCTGCCCCAACATT
TCTGCAGAGAACGCACTGAACATAGAATTCATGGCTGTAATAAGGCTAGA
GCTAGACAGACCACTTTTTGCTAAGGTGATTTATCGATTCTTTCTTTCCC
AATAAACCAAAAAGAGCTACGCTAGATCAATTTCTTTTTTTCTTTTTCTT
TTTCAGTGTTTTCATAAAACAGAGAAGCCTCCCCCG
back to top