CX309105

Overview
NameCX309105
Unique NameCX309105
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length320
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008F03Rv AbsLeaSub1 Citrus clementina cDNA clone C21008F03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309105 ID=CX309105|Name=CX309105|organism=Citrus clementina|type=EST|length=320bp
GCGGGCGTATGGATTAAGGCACCTGACCCAATCAAGCGGGTTTGGGTTTA
GACATTGAAATATGGGTAAAATGTCCGCGCATTTGAAATGATGCATGATA
TTATGAAGAAAGGATAAGTGATTGACGAATTGTAAACTCTAGAGGTCTCG
CGTTCGAATCCTCCTCGAGCATCGAAATGTTGACAAAAGTGTGATCTTGA
GTCGGGAGGGATTTTTAACAAAAAATGGAAGTATTGGGGCAGTTGTCTAA
ATATTGGAATTCTTTGGGCTGACTTTTTGGCTTCAGGTTCCAAAATATGG
AAAGTTAGGTGGGGTTTTGT
back to top