CX309120

Overview
NameCX309120
Unique NameCX309120
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length415
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC21008G07Rv AbsLeaSub1 Citrus clementina cDNA clone C21008G07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309120 ID=CX309120|Name=CX309120|organism=Citrus clementina|type=EST|length=415bp
TCAAATAGAACAGGTTAAACAAAAGACGCTTATCATATGGGGTGAGGATG
ACCAGGTTATTAGCAGCAAGCTTGCGGTGAGATTGCACTGTGAATTACCA
AATGCAATTATACGCCAAATTCCAGACTGCGGTCACCTTCCTCATGTGGA
AAAGCCAGGCGCTGTTGCCAAGTTGATAGTGGAATTTATTCAAGAAAACT
GCATTTCAGAACCTCAGTTAGTTTCTCAGCGTTGAAAGTCCATTCCCTAT
CTCTGCTTCCATTTACTTTAGCTCGTTCAGTGTATGTGTCAAGCAGCAAT
TTCACTCATTCCTCTTCGAGAATTCAATCACTGACTTCTTGTATTAAGGC
GGAATTCAGGATACAGTAAAAGTTCATTATGTCATTCAAAANAAAAAAAA
AAAAAAAAAAAAAAA
back to top