CX309123

Overview
NameCX309123
Unique NameCX309123
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length512
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX309123_ssr296 microsatellite CX309123_ssr296:296..307.
Ccv1_Contig975 contig Ccv1_Contig975:1..512. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21008G10Rv AbsLeaSub1 Citrus clementina cDNA clone C21008G10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309123 ID=CX309123|Name=CX309123|organism=Citrus clementina|type=EST|length=512bp
TTTGATCTACATTTGTGTCAGGTGAAAATGCAGATATGCTTATGCCAGAA
ATTGTTTTTCCATTGAAAACCATAAGAGCAGTCTTGGTGGAGGCTACAAG
TGAGATGTTAGCAAGACTTTGAAATTGAGGCTCTTAAGGTGGCTCAGCTT
GTCTTTCCAAGAATATTTGCAAAGAAAGTTCCAGCTGATACAAGCCTCCA
GAGTAAAACAAAGGCGTAATGGAGGCTTCTATCAGCTTTCACTGGGTGCT
GTTATGGTTACGGTGATTTATAATCCAAATTCTCATGGCACATTATATTT
ATTTATTATTTGTTTGAAAAGCATACATTAAGCTTTTTCATAAACTATAC
ACGAACAAGAAACGGAATATATTGGTCATCAGGAGTTGCGCCTTAGATAA
ATAATACATGGATGCTCCAACTTCTTATATGCAGTTTATTTTTTTAAAAA
AAAAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAA
back to top