CX309124

Overview
NameCX309124
Unique NameCX309124
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length243
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig967 contig Ccv1_Contig967:1..243. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21008G11Rv AbsLeaSub1 Citrus clementina cDNA clone C21008G11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309124 ID=CX309124|Name=CX309124|organism=Citrus clementina|type=EST|length=243bp
GCGGGGTTTTGGTATAGAAAAGGAGAAGGCACTAGATGTTATCGACCGGG
TTGATGTTCTTAGATAATTTGCGGAATGATATATACAATCATTATTGGAG
TGATTGAGAGTAATACCTTATAAAAGAGGCCTTGTCATGCATGTTACTTG
AGATATATGTTGACCTTCGAAATGAGGGTATGTCTCGAGACCAAAGTCCT
CCCTTCTTCGGGCATTCCATATTTGTGAAGAAGCACCTAGTGG
back to top