CX309125

Overview
NameCX309125
Unique NameCX309125
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length350
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX309125_ssr257 microsatellite CX309125_ssr257:257..268.
Ccv1_Contig9584 contig Ccv1_Contig9584:9..358. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21008G12Rv AbsLeaSub1 Citrus clementina cDNA clone C21008G12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309125 ID=CX309125|Name=CX309125|organism=Citrus clementina|type=EST|length=350bp
GCGGGGGATCAAAGCAAAAGCAGATCTTTAACAAGAGCTTACAAAGAGTA
AAAGAGAGAAGGGCATCTGAAGAATATATAGAAAATTAAGAATGAGTTCA
ACAAGCAGAGCATGGATGGTAGCAGCAAGTGTTGCAGCAGTTGAGGCCAT
GAAAGATCAAGGGTTCTGTAGATGGAACTACACACTCAGATCATTACACC
AACAAGCCAAGAACAGTATAAGATCATCAGTTTCTCAATCATCAAAGAAG
CTTTCCTCTTCTTCTTCTTCATCTTCTGCTGCAGTGGTTTCAAGCAAATT
GATGAGAGACCCCAAGGCCAAGCAATCAGAGGAGTCTTTAAGGACAGTCG
back to top