DY258018

Overview
NameDY258018
Unique NameDY258018
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length383
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2CF02ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258018 ID=DY258018; Name=DY258018; organism=Citrus clementina; type=EST; length=383bp
GGCTCAAGCACAACTACTTACCTTTTGAGTTTTGAATACGGTTCAGTCGA
AGCCAGCAGAAATCGTTTGCCTTCCTGATTTGAAGATTATGGGAACTCCT
TGCGCAGGTTATACCGATTGGTCGGAGGGGCTTATAGCCACAACTTTTTC
ACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTGGTCC
CGCAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGCAGTATTA
GTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATTACC
CGTCAATTGTATGATGGTCTCAATTTGGTTCAATTTAACTTGTAAGATCT
CTTGATATATATAAGAGATTCTCTTTGTCTAGA
back to top