DY258019

Overview
NameDY258019
Unique NameDY258019
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length233
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2CF03ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258019 ID=DY258019; Name=DY258019; organism=Citrus clementina; type=EST; length=233bp
ATTGTACTTTATTTTATCGATGCAAAATGGACTATTGGCTAAGGCTAGTT
TAAAAATAATCAGTTGTGAAGAAAATCAATTAAATGTTTGGTAGATTTTA
TTTTTAGAAATATTATGAGTTTTGAAAGCACTGTTAAACTGTCGAGAGAA
ACAAATAACTGAAATGTACATTATGTAGGATAAAGTTTACTTCTACATAT
AAAAATATGTACAAAAAAAAAAAAAAAAAAAAA
back to top