DY258021

Overview
NameDY258021
Unique NameDY258021
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1305
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAB2CF08ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258021 ID=DY258021; Name=DY258021; organism=Citrus clementina; type=EST; length=1305bp
GACTGCGACGGTTACAAAAACCTCAAATGAAAACTCTCTCACTTTCTAAA
AAAGGGGGTCCTCAATTAAACCCTTTCACCAGCTCGTTTGCAAATCATTT
AACATCATCATCATCGTTCATCACCATTTTTACGCAAAGAAACAAATAGT
TTGATCAGTTGAAAGCAAAAAAGCATGTCCGGGCAAGACATCGAGAGAGG
GCAAAGAGCGAACAAGAACAGAACAGGCAGCAGCAGCAACAACAACAACG
GTGCCCACCTTCCATCACCAACGTATCTGATCGAAGACACAGAGACCCAA
TGGACTTCTTGGCTCGTTCCCATGTTTGTTGTTGCTAATGTTGCCGTCTT
CATTGTTGTCATGTACATCAACGATTGTCCAAAGCATGATCAAGCGTTTA
AAGGCAAGTGCGTGGCAAGGTTCTTGGGGCGGTTCTCGTTTGAGCCTTTG
AGAAAGAATCCTCTTTTTGGTCCCTCTTCTCACACATTGGAGAAATTGGG
TGGTCTTGAATGGACCAAAGTGGTGCAAAAACATCAAGGATGGAGGCTTA
TCACTTGTATCTGGTTGCACGCCGGTATTATTCATCTCCTCGTAAACATG
CTATGCCTGGTTTTCATTGGTATTCGCCTTGAACAGCAATTTGGGTTCGT
GCGGATTGGAGTTATTTACCTGTTATCTGGATTCGGTGGGAGTGTTCTTT
CCTGCCTATTTATTCGAAACAGCATCTCTGTTGGTGCCTCCGGTGCACTT
TTTGGGCTTCTGGGAGCAATGCTTTCAGAACTACTTACTAACTGGAGTCT
TTATACCAACAAGGCTGCAGCCTTGATTACTCTTTTGGTCATCATTGCAA
TTAATCTCGCTATAGGAATTCTGCCGCATGTTGATAATTTCGCTCACNAT
GGGTGGATTTCTCACTGGGGTTCTTCCTTGGTTTTGTCTTGTTGGCCCCG
TCTCGGTACGGATGGGCTTGAGGGCAGGGAACTTCCCTGGAATTGCGCCA
TAAAAATCCAAGTAAAAAAAACATCAATACGTGTTAAGGGCTGGGCCTCT
CTGGTTCCACTAATTGCAGGGATTAAAAGTTGCCCTGGGGGAAGCTCCTT
CCGGGGAAAAAAAGGGTAAGGGATCGTTGGAAAAGGGGGTTCCCTAAAAT
AAGCCGGGGTTTCCCCCCCCTCCCGTTGGGAAATTTGGAAAAGGAAAAAG
GGGGGAAAAATGGGGAAATTGTGCCAAGCCCCTTTCCCTTTTTTCCAAAT
GGGAAAAAGGTGGCGGGGGGGAAAAATAAATTTAAAAAGCCCCTTTTTAA
AAAAA
back to top