DY258024

Overview
NameDY258024
Unique NameDY258024
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length249
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2CF12ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258024 ID=DY258024; Name=DY258024; organism=Citrus clementina; type=EST; length=249bp
GAGGCACAAAAATGCCTTATCTGCAACTTTGACAAAAAGGTAATCAATCA
GACAATCCTTTTCCATGCTCATAAAAGCATTGTTGTATGTTGTATATGTA
TGTGTAGCTATTAGCTAGCTAAGGCTATGATCTTAATTTAGAATTAAGTC
AATTGCATCGTTAAACAATATGAGAATTCAATTTAGTTTTTAGTTCATGA
TTTTAAGACCTATTTGAATTTATGGATTATGAAACCGTGCATTTGAATG
back to top