DY258026

Overview
NameDY258026
Unique NameDY258026
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length264
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2CG06ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258026 ID=DY258026; Name=DY258026; organism=Citrus clementina; type=EST; length=264bp
GGTGGATCTTCACTAGGTTACCTCTTTGGTGGTGGCAGCAACTGAGATGT
GCCTCCCTATCTCCATATGAAGTATTGTTGTGATTTTTGTGAAAATGTAA
TTTGGATGAGGCAATGCACTCATCGTTTACATAAACAATTCAACTCGTTT
GATGTTGTGATGTAATATAAAGATGGTGTGGTTGTCTGCTTAATTCAATC
AAGAATATTGTTATGCATAAACTTTTGTTACAAGACGCAATTGCAATCAA
AAAGTGAAGTTTTA
back to top