DY258038

Overview
NameDY258038
Unique NameDY258038
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1215
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAB2DA02ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258038 ID=DY258038; Name=DY258038; organism=Citrus clementina; type=EST; length=1215bp
GCCTGGCTGATCTGATTCCATTCCATTTACCCACTACTTGGTTGGGCCGA
TGGGGAGACAGCATATGATTATAGACAGGAAGCATGTGAGTGCTTGGTGG
GATGATATTATCAACAGGCCGTCCTGAAATAAAGTCCTTGAACTTTGTAA
GACTCCTTTCGGCTGAACTTGATTGTATGTGTTTCAATTTTCGGGCTTGT
GTTTTACTTCTCTACTACTTGGTTTGTTTCTGTCTGTGGGATATGTATCT
TGCGTATGTGTTTCAATAAATAAGTGTTTGGAGTTGGACCGAAAAAAAAA
AAAAAACCAAATTAGAAAAAGCACTTTCCAAAAAACAAGATTCAAGTGTA
ATTCAAGTAAAAAAAGATTCTCAAACAAAAAAAAGAAAATTTTGGATCCG
CCGGTTCCACTTCTTCCCTTTACTTCATAAAACTACTGATCCTGGCTTCT
TTTTTAGTTTTTGTGGCCAATTCCCCCTAGCGCGAACTTAATGAATATTA
TCGGGCCCCCTTTTCTTGCTATGTTGTCGGGAAAATCCTTGTTTTACCCA
ATGTTAGCCGTATTTATGAAACTCCCCTTTCCCCTATTGGGCCAAATATT
TAAAAGACCGCCACTAATCCCCGTTCCCTAAGTTATCCCACCTATGTGGC
CAATTGAAATTTACAACCATATTAATTTTGTAAAACTCTGTCTAAAATTT
TGGTAAAATCACCTCTTTTTTACCCGTCAGCCCCCACGGCGCAAAACCCC
CTTAAAATCAAAAAAATTAACCAAGGAAGGGCTAAAATGTGTTCCCTTTT
TGGAATCACCTCCACTATTAAGAATTGGGACCCCCGCCCCCACGGGGCAA
AAACTCTCAATTGGGGAAAAGGGCCCCTTACTCAAACCACCCCCCAAAAC
AATTTTTTTGGGGTTCAAGGGCCGGAAAAAAAAAAAAATAGGACCCCCAA
AAGGGACCCCCCCCTTTAAAATTTTGCCGGCGAAAACCCCCGCAAAAGTT
GGTCGAAAAAAGGAAAGGAAAAAAAAAAAAAATGGGGGGGCCCTTTTGGG
CTTCTGGCCAAATTTATTTTTTTTACCCCCTTGGCGCCAAAAACCCCCCC
CCCCCCCCCCCCCTTTAAATCTCCCCCACCTAAAAGCGGCGGCCTTCCGG
GGTGTGGGGTTTTTTTTTTCCCCTTTTTTGCCACAACTTTGGAGGGGTGT
TTTTTTTTCCAAACC
back to top