DY258039

Overview
NameDY258039
Unique NameDY258039
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length279
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2DA03ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258039 ID=DY258039; Name=DY258039; organism=Citrus clementina; type=EST; length=279bp
GACACAAACAAATTTGTTCCTGAACTGAGCTGAACTCTTCGTTCCGCTCC
GAAATTCTCGTCTTTTATTTGTCGTTAGCCCAATTATGAGGGCTAAGTGG
CGTAAGAAGCGTATGCGTAGGTTGAAGCGCAAGAGGAGGAAGATGCGTGC
AAGGTCCAAGTAAACCTCGTGGCCCGCACCGGACATCTCACCATGTTTTG
GTAAACAATAACCGATATTGATACTTTTATATTGAATCATCTAAACAGTA
ATAAACTCCATCTGTTCAACATATAAACC
back to top